View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15324_low_71 (Length: 204)

Name: NF15324_low_71
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15324_low_71
NF15324_low_71
[»] chr2 (2 HSPs)
chr2 (16-186)||(38374333-38374503)
chr2 (28-81)||(35053196-35053249)


Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 16 - 186
Target Start/End: Complemental strand, 38374503 - 38374333
Alignment:
Q  16 aatatgagttgagaccaaaactgcaaaaaatgtgatacttgaggaccaaaaagtttgattttaaaagatgataaatatgttttcgtttctatgataaaat 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38374503 aatatgagttgagaccaaaactgcaaaaaatgtgatacttgaggaccaaaaagtttgattttaaaagatgataaatatgttttcgtttctatgataaaat 38374404  T
Q  116 aggaggcaaagaatttcaattaagtctatgttatatattaccggtttgtatcgacccctctcataatatgt 186  Q
    |||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||    
T  38374403 aggaggtaaagaatttcaattaagcctatgttatatattaccggtttgtatcgatccctctcataatatgt 38374333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 35053196 - 35053249
Alignment:
Q  28 gaccaaaactgcaaaaaatgtgatacttgaggaccaaaaagtttgattttaaaa 81  Q
    |||||||| |||||||||||||| | | |||||||||||||||  |||||||||    
T  35053196 gaccaaaattgcaaaaaatgtgaaattagaggaccaaaaagttcaattttaaaa 35053249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University