View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15324_low_68 (Length: 208)

Name: NF15324_low_68
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15324_low_68
NF15324_low_68
[»] chr7 (1 HSPs)
chr7 (12-74)||(55260-55322)


Alignment Details
Target: chr7 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 12 - 74
Target Start/End: Original strand, 55260 - 55322
Alignment:
Q  12 catcatcaattatatttaatagaaattgtggtagtagtaaacacaaatgttatagaactattg 74  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  55260 catcatcaattatatttaatagaaattgtggtagtagcaaacacaaatgttatagaactattg 55322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University