View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15322_high_39 (Length: 239)

Name: NF15322_high_39
Description: NF15322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15322_high_39
NF15322_high_39
[»] chr2 (1 HSPs)
chr2 (1-237)||(40831609-40831846)


Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 40831846 - 40831609
Alignment:
Q  1 ctgatgtaaacaggttaaaaatcaagcagtaaaattcatgggttctttgttaatttaataatctatcaccaacaataacactactagctaaactagatag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40831846 ctgatgtaaacaggttaaaaatcaagcagtaaaattcatgggttctttgttaatttaataatctatcaccaacaataacactactagctaaactagatag 40831747  T
Q  101 ataagtaaaagaagg-nnnnnnntatgtgacacaaagctatagttgcaaaatgaatgaggtgagtgattgattggaaattggtcagtttatcatccccta 199  Q
    |||||||||||||||        ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  40831746 ataagtaaaagaaggaaaaaaaatatgtgacacaaagctatagttgtaaaatgaatgaggtgagtgattgattggaaattggtcattttatcatccccta 40831647  T
Q  200 tttcttagaccatgcccagagagaatacatagccacca 237  Q
    ||||||||||||||||||||||||||||||||||||||    
T  40831646 tttcttagaccatgcccagagagaatacatagccacca 40831609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University