View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15320_low_14 (Length: 274)

Name: NF15320_low_14
Description: NF15320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15320_low_14
NF15320_low_14
[»] chr8 (2 HSPs)
chr8 (80-150)||(35381651-35381721)
chr8 (1-43)||(35381572-35381614)


Alignment Details
Target: chr8 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 80 - 150
Target Start/End: Original strand, 35381651 - 35381721
Alignment:
Q  80 ctgcttgtattctcatctcatttcattttcacctctacactacaccaccacactctgactatataataata 150  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  35381651 ctgcttgtattctcatctcatttcattttcacctctacactacaccaccatactctgactatataataata 35381721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 35381572 - 35381614
Alignment:
Q  1 taatttgagctattaggtttagattaatttttctatttatact 43  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  35381572 taatttgagctattaggtttagattaatttttctatttatact 35381614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University