View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15315_high_9 (Length: 406)

Name: NF15315_high_9
Description: NF15315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15315_high_9
NF15315_high_9
[»] chr5 (2 HSPs)
chr5 (311-389)||(5039273-5039351)
chr5 (222-273)||(5039351-5039402)


Alignment Details
Target: chr5 (Bit Score: 79; Significance: 8e-37; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 311 - 389
Target Start/End: Complemental strand, 5039351 - 5039273
Alignment:
Q  311 atagacctgcactattgtagtcttgctaagtatgtggacttcataagaaagtaacaaaatgaatattgaagaaacagct 389  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5039351 atagacctgcactattgtagtcttgctaagtatgtggacttcataagaaagtaacaaaatgaatattgaagaaacagct 5039273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 5039402 - 5039351
Alignment:
Q  222 tataaaagatttataaacaaatctaggtcataccttattctaaatttcaaaa 273  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  5039402 tataaaagatttgtaaacaaatctaggtcataccttattctaaatttcaaaa 5039351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University