View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15314_high_1 (Length: 362)

Name: NF15314_high_1
Description: NF15314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15314_high_1
NF15314_high_1
[»] chr2 (2 HSPs)
chr2 (15-217)||(26211192-26211394)
chr2 (260-306)||(26211437-26211483)


Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 217
Target Start/End: Original strand, 26211192 - 26211394
Alignment:
Q  15 gagatgaacgtggcggtagaggtcgttgagttcgacgccgcagtaaccattgaattcgggaatttcaaagtatgagtatggagaaagaagatcttgaagt 114  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26211192 gagatggacgtggcggtagaggtcgttgagttcgacgccgcagtaaccgttgaattcgggaatttcaaagtatgagtatggagaaagaagatcttgaagt 26211291  T
Q  115 gattcgtacagtgaatgaagcactgagagaagctgtgttggaagtacgttttggagaactgttagtaaccctaacaatgaccacatttgtgacaatatct 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26211292 gattcgtacagtgaatgaagcactgagagaagctgtgttggaagtacgttttggagaactgttagtaaccctaacaatgaccacatttgtgacaatatct 26211391  T
Q  215 cca 217  Q
    |||    
T  26211392 cca 26211394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 260 - 306
Target Start/End: Original strand, 26211437 - 26211483
Alignment:
Q  260 aataattgaataggaacgtgaatgagaatgtttctttttgaggttgt 306  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  26211437 aataattgaataggaacgtgaatgagaatgtttctttttgaggttgt 26211483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University