View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15312_low_15 (Length: 204)

Name: NF15312_low_15
Description: NF15312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15312_low_15
NF15312_low_15
[»] scaffold0693 (1 HSPs)
scaffold0693 (1-198)||(3201-3394)


Alignment Details
Target: scaffold0693 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: scaffold0693
Description:

Target: scaffold0693; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 3201 - 3394
Alignment:
Q  1 tgctgggtataacatgcttcaattatgcaaacactctttctcagcttgttctacaatacggaacttcaatgattcttattatatgcacatggcttggatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3201 tgctgggtataacatgcttcaattatgcaaacactctttctcagcttgttctacaatacggaacttcaatgattcttattatatgcacatggcttggatt 3300  T
Q  101 agtttcttactagatcaggtaaattaactcttttcttatttagttgagaatacatattatatatattaaacttggttatacatgataatataaggtat 198  Q
    |||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3301 agtttcttactagatcaggtaaattaactct----ttatttagttgagaatacatattatatatattaaacttggttatacatgataatataaggtat 3394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University