View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15312_high_8 (Length: 229)

Name: NF15312_high_8
Description: NF15312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15312_high_8
NF15312_high_8
[»] chr8 (2 HSPs)
chr8 (38-180)||(2747797-2747937)
chr8 (73-180)||(2755841-2755945)


Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 38 - 180
Target Start/End: Complemental strand, 2747937 - 2747797
Alignment:
Q  38 tgttgcagatgaaaaccatgaatcacaacatggtaaacaaatttgatcggttatggtgtaatatcttgatattttctgtcttcattaaactttatattat 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2747937 tgttgcagatgaaaaccatgaatcacaacatggtaaacaaatttgatcggttatggtgtaatatcttgatattttctgtcttcattaaactttatattat 2747838  T
Q  138 ccatataccggtctaatgcagcacccgaatggaaggatacggt 180  Q
    ||  ||||||||||||||||||||||||||||| |||||||||    
T  2747837 cc--ataccggtctaatgcagcacccgaatggacggatacggt 2747797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 73 - 180
Target Start/End: Complemental strand, 2755945 - 2755841
Alignment:
Q  73 aacaaatttgatcggttatggtgtaatatcttgatatttt-ctgtcttcattaaactttatattatccatataccggtctaatgcagcacccgaatggaa 171  Q
    ||||||||||||| |||||||||||||  ||| ||||||| |||| |||||| |||||||||  || ||||  | ||||||||||||| |||||| |||     
T  2755945 aacaaatttgatcagttatggtgtaat--cttaatatttttctgttttcattgaactttataacatgcata--ctggtctaatgcagcccccgaacggac 2755850  T
Q  172 ggatacggt 180  Q
    |||||||||    
T  2755849 ggatacggt 2755841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University