View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15312_high_5 (Length: 291)

Name: NF15312_high_5
Description: NF15312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15312_high_5
NF15312_high_5
[»] chr8 (2 HSPs)
chr8 (90-253)||(2748261-2748424)
chr8 (145-186)||(2756376-2756417)


Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 90 - 253
Target Start/End: Original strand, 2748261 - 2748424
Alignment:
Q  90 taagaatggtatatgactttgtcccttgaaattacaaggtcagggctaatagacataatttcaataccttggcagtgcagtatccaactttttcatccgt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2748261 taagaatggtatatgactttgtcccttgaaattacaaggtcagggctaatagacataatttcaataccttggcagtgcagtatccaactttttcatccgt 2748360  T
Q  190 gaatccgaatggatcatcaccaccgccaccgccaccaagaaggcgccgagcagtgccagaaaca 253  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2748361 gaatccgaatggatcatcaccaccgccaccgccaccaagaaggcgccgagcagtgccagaaaca 2748424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 145 - 186
Target Start/End: Original strand, 2756376 - 2756417
Alignment:
Q  145 taatttcaataccttggcagtgcagtatccaactttttcatc 186  Q
    ||||||||||||||||||||| |||||||||| || ||||||    
T  2756376 taatttcaataccttggcagtacagtatccaatttcttcatc 2756417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University