View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15311_high_42 (Length: 213)

Name: NF15311_high_42
Description: NF15311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15311_high_42
NF15311_high_42
[»] chr6 (1 HSPs)
chr6 (100-195)||(25166472-25166567)


Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 100 - 195
Target Start/End: Original strand, 25166472 - 25166567
Alignment:
Q  100 tggaagcatgtgcataagagaagtgaagacacgcataatatgcatgtgattggtgagtttaatcaacttggtcggtcccacgtgtctatttattaa 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25166472 tggaagcatgtgcataagagaagtgaagacacgcataatatgcatgtgattggtgagtttaatcaacttggtcggtcccacgtgtctatttattaa 25166567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University