View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1530_low_26 (Length: 232)

Name: NF1530_low_26
Description: NF1530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1530_low_26
NF1530_low_26
[»] chr3 (1 HSPs)
chr3 (18-232)||(54277732-54277946)


Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 54277946 - 54277732
Alignment:
Q  18 tccacaaatcccttcagactttccaatgtttctcttcatcctaataaaccctttctcaccccactttgctccccatgaattcttcactataatgtaatcc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54277946 tccacaaatcccttcagactttccaatgtttctcttcatcctaataaaccctttctcaccccactttgctccccatgaattcttcactataatgtaatcc 54277847  T
Q  118 aaaccctttgatgtaccatatccaacggctgacacaccctgatctagctcacttccacaatgtccatcaaacacaccctacaaatggtagttaaataatc 217  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54277846 aaaccctttgatgtaccatatccaacggctgacacaccatgatctagctcacttccacaatgtccatcaaacacaccctacaaatggtagttaaataatc 54277747  T
Q  218 agttcatacaattcc 232  Q
    |||||||||||||||    
T  54277746 agttcatacaattcc 54277732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University