View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1530_high_12 (Length: 249)

Name: NF1530_high_12
Description: NF1530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1530_high_12
NF1530_high_12
[»] chr7 (1 HSPs)
chr7 (143-249)||(6701510-6701617)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 143 - 249
Target Start/End: Original strand, 6701510 - 6701617
Alignment:
Q  143 gtgaattctaacggtataaaatagatgatatgacagatggtaaatcagaattcgcttaaacaataggggttcaaa-tatctttaatctcagaattccctc 241  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||| |||||||||    
T  6701510 gtgaattctaacggtataaaatagatgatatgtcagatggtaaatcagaattcgcttaaacagtagggtttcaaagtatctttaatctcaaaattccctc 6701609  T
Q  242 atgggttt 249  Q
    ||||||||    
T  6701610 atgggttt 6701617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University