View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15308_high_5 (Length: 248)

Name: NF15308_high_5
Description: NF15308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15308_high_5
NF15308_high_5
[»] chr3 (1 HSPs)
chr3 (15-248)||(41247831-41248064)


Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 15 - 248
Target Start/End: Complemental strand, 41248064 - 41247831
Alignment:
Q  15 tatgtgaccgtgggagtatttgattggcttatttgagttatctttaggtgcatcgaatgtattttaggaaaatgtcacaaacaaataaataaatgatgaa 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  41248064 tatgtgaccgtgggagtatttgattggcttatttgagttatctttaggtgcatccaatgtattttaggaaaatgtcacaaacaaataaataaatgatgaa 41247965  T
Q  115 ggtgtacaacacaggaaaatgttagcatatggaagtgatgaggaatggtagtgagacaaatatctgcaacttgtgtcgttccttacagagctttcaatgt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41247964 ggtgtacaacacaggaaaatgttagcatatggaagtgatgaggaatggtagtgagacaaatatctgcaacttgtgtcgttccttacagagctttcaatgt 41247865  T
Q  215 gcagacacggcatctccgtgtctacgatgatcac 248  Q
    ||||||||||||||||||||||||||||||||||    
T  41247864 gcagacacggcatctccgtgtctacgatgatcac 41247831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University