View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15306_low_5 (Length: 323)

Name: NF15306_low_5
Description: NF15306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15306_low_5
NF15306_low_5
[»] chr5 (1 HSPs)
chr5 (251-310)||(12616110-12616169)


Alignment Details
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 251 - 310
Target Start/End: Original strand, 12616110 - 12616169
Alignment:
Q  251 atactaatggaaaagtgaccaattcagatggagactgaaccaaaaattgaagagcttact 310  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12616110 atactaatggaaaagtgaccaattcagatggagactgaaccaaaaattgaagagcttact 12616169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University