View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15302_low_94 (Length: 247)

Name: NF15302_low_94
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15302_low_94
NF15302_low_94
[»] chr8 (1 HSPs)
chr8 (24-223)||(6897800-6898000)


Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 24 - 223
Target Start/End: Original strand, 6897800 - 6898000
Alignment:
Q  24 caaatgggaatttggtactatacaaaccagaatctatgcatgtcaagtttcaaattgaaacagaaagtgtggtgtcccacaaacaacactggtttctttt 123  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6897800 caaatgggaatttggtactgtacaaaccagaatctatgcatgtcaagtttcaaattgaaacagaaagtgtggtgtcccacaaacaacactggtttctttt 6897899  T
Q  124 ctagtactc--tgtgtactgtattgtctgctatatgacttatacgtgtaattgagttcagcagcttgaacat---atgaagggatgtttccttaaaccat 218  Q
    |||||||||  |||||||||||||||||||  ||||||||||  ||||||||||||||||||||||||||||   |||||||||||||||||||||||||    
T  6897900 ctagtactctttgtgtactgtattgtctgc--tatgacttat--gtgtaattgagttcagcagcttgaacatatgatgaagggatgtttccttaaaccat 6897995  T
Q  219 ataga 223  Q
    |||||    
T  6897996 ataga 6898000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University