View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15302_low_67 (Length: 311)

Name: NF15302_low_67
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15302_low_67
NF15302_low_67
[»] chr7 (2 HSPs)
chr7 (85-293)||(8592195-8592403)
chr7 (20-61)||(8592135-8592176)


Alignment Details
Target: chr7 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 85 - 293
Target Start/End: Original strand, 8592195 - 8592403
Alignment:
Q  85 gaacagaaatactaaattcaatttgaggaaactccgagagatttgtctactggtnnnnnnncaagtcttaaattttagagatcttaggtttcaacttctc 184  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||| ||||       |||||||||||||||||||||||||||||||||||||||    
T  8592195 gaacagaaatactaaattcaatttgaggaaactccgagagatctgtctagtggtaaaaagacaagtcttaaattttagagatcttaggtttcaacttctc 8592294  T
Q  185 nnnnnnnnnngaagtgagataaatataaatacatttgtaatattctttcagctgttttggactggacaccatcttttcaccctaaattttatgtagccaa 284  Q
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||    
T  8592295 ttctttttttgaagtgagataaatataaatacatttgtaatattctttcagctgttttggactggacaccatcctttcatcctaaattttatgtagccaa 8592394  T
Q  285 aagaatact 293  Q
    | |||||||    
T  8592395 aggaatact 8592403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 8592135 - 8592176
Alignment:
Q  20 aaataccggggaaacttgacattgcgctaacaacgtattgta 61  Q
    ||||||| ||||||||||||||||||||||||||||||||||    
T  8592135 aaataccagggaaacttgacattgcgctaacaacgtattgta 8592176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University