View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1529_low_9 (Length: 424)

Name: NF1529_low_9
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1529_low_9
NF1529_low_9
[»] scaffold0683 (1 HSPs)
scaffold0683 (10-58)||(4866-4914)


Alignment Details
Target: scaffold0683 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0683
Description:

Target: scaffold0683; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 10 - 58
Target Start/End: Complemental strand, 4914 - 4866
Alignment:
Q  10 catcatcagattttccttaacatggctcttcctcacactatatgtatca 58  Q
    |||||| ||||||||||| ||||||||||||||||||||||||||||||    
T  4914 catcataagattttccttgacatggctcttcctcacactatatgtatca 4866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University