View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1529_low_58 (Length: 223)

Name: NF1529_low_58
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1529_low_58
NF1529_low_58
[»] chr1 (1 HSPs)
chr1 (18-149)||(36677477-36677608)


Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 18 - 149
Target Start/End: Complemental strand, 36677608 - 36677477
Alignment:
Q  18 attgaccctttatgctatattaagtttgcatcatttgcctttagtttatattaaattacgcatgcttgtcctttagttcgagctttttctcgaattattg 117  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36677608 attgaccctttatgctatattaagtttgcaccatttgcctttagtttatattaaattacgcatgcttgtcctttagttcgagctttttctcgaattattg 36677509  T
Q  118 tcataaaatattaaaatctaatccaaactgtg 149  Q
    ||||||||||||||||||||||||||||||||    
T  36677508 tcataaaatattaaaatctaatccaaactgtg 36677477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University