View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1529_low_28 (Length: 303)

Name: NF1529_low_28
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1529_low_28
NF1529_low_28
[»] chr8 (2 HSPs)
chr8 (98-151)||(27572070-27572123)
chr8 (230-303)||(27572202-27572275)


Alignment Details
Target: chr8 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 98 - 151
Target Start/End: Original strand, 27572070 - 27572123
Alignment:
Q  98 cggctgttatgagatgcaaaatcgtctattaaattatcataataattatttaac 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27572070 cggctgttatgagatgcaaaatcgtctattaaattatcataataattatttaac 27572123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 230 - 303
Target Start/End: Original strand, 27572202 - 27572275
Alignment:
Q  230 gaaaaactaagttccatagaagcagcannnnnnnngaagaagctaaatcaagcaccagagataatcgaacctga 303  Q
    |||||||||||||||||||||||| ||        |||||||||||||||||||||||||| ||||||||||||    
T  27572202 gaaaaactaagttccatagaagcaacattttttttgaagaagctaaatcaagcaccagagaaaatcgaacctga 27572275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University