View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1529_high_36 (Length: 265)

Name: NF1529_high_36
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1529_high_36
NF1529_high_36
[»] chr1 (1 HSPs)
chr1 (25-216)||(6320026-6320217)


Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 25 - 216
Target Start/End: Original strand, 6320026 - 6320217
Alignment:
Q  25 catgtccaagaatatggtgagggaaactggaattcagtccggaaatgtaccggacttgctcgctgtgggaaaagctgtcgtctacgatgggcaaatcatt 124  Q
    ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6320026 catgttcaaaaatatggtgagggaaactggaattcagtccggaaatgtaccggacttgctcgctgtgggaaaagctgtcgtctacgatgggcaaatcatt 6320125  T
Q  125 tgagacctgatctcagaaagggtgcaattactgctgaagaagaacgccgaatcattgagttgcatcataagatgggaaataaatgggctcaa 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6320126 tgagacctgatctcagaaagggtgcaattactgctgaagaagaacgccgaatcattgagttgcatcataagatgggaaataaatgggctcaa 6320217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University