View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15299_low_63 (Length: 227)

Name: NF15299_low_63
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15299_low_63
NF15299_low_63
[»] scaffold0036 (1 HSPs)
scaffold0036 (16-204)||(9432-9621)


Alignment Details
Target: scaffold0036 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 9432 - 9621
Alignment:
Q  16 tatccaatttcttaacagatggaatcagtgtaatgtgtaacatgcttctagttaaacaagnnnnnnntaactttgtgaaacg-cccatccctactgattg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||| |||| |||||||||||||||||    
T  9432 tatccaatttcttaacagatggaatcagtgtaatgtgtaacatgcttctagttaaacaagaaaaaaataactttgtggaacgccccatccctactgattg 9531  T
Q  115 aattctcatattgtagcagacaatgttttacatacnnnnnnntatacacggaagaaacaattagcttttcttatatgataagtacaatat 204  Q
    |||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||    
T  9532 aattctcatattgtagcagacaatgttttacatacaaaaaattatacacggaagaaacaattagcttttcttatatgataagtacaatat 9621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University