View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15299_high_48 (Length: 274)

Name: NF15299_high_48
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15299_high_48
NF15299_high_48
[»] chr3 (1 HSPs)
chr3 (149-258)||(16005807-16005916)


Alignment Details
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 149 - 258
Target Start/End: Complemental strand, 16005916 - 16005807
Alignment:
Q  149 gcacaaatatctctcgggaaagaaactaaagtaaagtcatggaaaaaatatcaaatcaaacttcatcttgttcagcctccagattctgtgcaacttcttc 248  Q
    |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16005916 gcacaaatatctcttgggaaagaaactaaagtaaagtcatggcaaaaatatcaaatcaaacttcatcttgttcagcctccagattctgtgcaacttcttc 16005817  T
Q  249 agcttgttct 258  Q
    ||||||||||    
T  16005816 agcttgttct 16005807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University