View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15298_high_20 (Length: 201)

Name: NF15298_high_20
Description: NF15298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15298_high_20
NF15298_high_20
[»] chr1 (2 HSPs)
chr1 (90-143)||(16859155-16859208)
chr1 (143-184)||(16859420-16859461)


Alignment Details
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 90 - 143
Target Start/End: Original strand, 16859155 - 16859208
Alignment:
Q  90 tctgttgtgtctttgtttgacaaggacaagagtgttagacaatagacatgcctt 143  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  16859155 tctgttgtgtctttgtttgacaaggacaagtgtgttagacaatagacatgcctt 16859208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 143 - 184
Target Start/End: Original strand, 16859420 - 16859461
Alignment:
Q  143 tggaacagcaccaccccttgatttgggttcactcccgcaact 184  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16859420 tggaacagcaccaccccttgatttgggttcactcccgcaact 16859461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University