View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15296_low_54 (Length: 249)

Name: NF15296_low_54
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15296_low_54
NF15296_low_54
[»] chr3 (1 HSPs)
chr3 (5-226)||(36441190-36441411)


Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 5 - 226
Target Start/End: Complemental strand, 36441411 - 36441190
Alignment:
Q  5 ctcccttcccgattcatctccccacccaaacagtttgccgccctagcatgctctatcatctccccatcacactttcagccaccaacaatcactattttgt 104  Q
    ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  36441411 ctcccttccagattcatttccccacccaaacagtttgccgccctagcatgctctatcatctccccatcacactttcagccaccaaccatcactattttgt 36441312  T
Q  105 gagatattgctcataaaaaggtttatcgtggtagtttatgcagaaaaggataaaaatggaaattcaagaaacataagcatttctcgctcatttcttcgct 204  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36441311 gagatattgctcataaagaggtttatcgtggtagtttatgcagaaaaggataaaaatggaaattcaagaaacataagcatttctcgctcatttcttcgct 36441212  T
Q  205 gcatagaggagaccatgaaaaa 226  Q
    |||||||| |||||||||||||    
T  36441211 gcatagagaagaccatgaaaaa 36441190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University