View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15296_low_48 (Length: 257)

Name: NF15296_low_48
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15296_low_48
NF15296_low_48
[»] chr4 (1 HSPs)
chr4 (6-243)||(4388342-4388580)


Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 6 - 243
Target Start/End: Original strand, 4388342 - 4388580
Alignment:
Q  6 catctcaaggaaaaaacaataaagcaagtgtcactgtttcggtttactcttcatgggatctatgacttggcaaaggaagctataaggagattggatgaca 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  4388342 catctcaaggaaaaaacaataaagcaagtgtcactgtttcggtttactcttcatgggatctatgacttggcaaaggaagctataaggagattggatggca 4388441  T
Q  106 aaattgttgaggaagacgactaaattgtcaattaggcaaagtatgatagaaagaagagcattctacatgaaaaacatgatagaaacaccaagagtgg-gg 204  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  4388442 aaattgttgaggaagacaactaaattgtcaattaggcaaagtatgatagaaagaagagcattctacatgaaaaacatgatagaaacaccaagagtggtgg 4388541  T
Q  205 taaattccaagactacatgtcttttaaggatgctttgat 243  Q
    |||||||||||||||||||||||||||||||||||||||    
T  4388542 taaattccaagactacatgtcttttaaggatgctttgat 4388580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University