View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15296_low_45 (Length: 266)

Name: NF15296_low_45
Description: NF15296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15296_low_45
NF15296_low_45
[»] chr5 (4 HSPs)
chr5 (18-201)||(41796610-41796793)
chr5 (18-96)||(41792904-41792982)
chr5 (27-115)||(41789961-41790049)
chr5 (18-106)||(41762635-41762723)


Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 41796610 - 41796793
Alignment:
Q  18 aaagggacttagtttgatatatcccttttgcagagacaaacatcaatatgggtgagatctttgaggatacttccaaattgggtaggactaactcacaaca 117  Q
    ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41796610 aaagggacttagtttgatatatcccttttgcagagagcaacatcaatatgggtgagatctttgaggatacttccaaattgggtaggactaactcacaaca 41796709  T
Q  118 caatagctgcatcacagtagtaaactctagaattcgcaatccctatagttgacacatcgataattgttggatcaaaatcagatc 201  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  41796710 caatagctacatcacagtagtaaactctagaattcgcaatccctatagttgacacattgataattgttggatcaaaatcagatc 41796793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 96
Target Start/End: Original strand, 41792904 - 41792982
Alignment:
Q  18 aaagggacttagtttgatatatcccttttgcagagacaaacatcaatatgggtgagatctttgaggatacttccaaatt 96  Q
    |||||||||| ||||||| |||| |||||| |||||  ||||||||| ||| |||||||||||||||||||||||||||    
T  41792904 aaagggactttgtttgatctatcacttttgtagagagcaacatcaatgtggatgagatctttgaggatacttccaaatt 41792982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 115
Target Start/End: Original strand, 41789961 - 41790049
Alignment:
Q  27 tagtttgatatatcccttttgcagagacaaacatcaatatgggtgagatctttgaggatacttccaaattgggtaggactaactcacaa 115  Q
    ||||||||| | ||||||||| |||||  ||||||||| ||||||||||||| |||||||| ||||||||  || ||||| ||||||||    
T  41789961 tagtttgatctttcccttttgtagagagcaacatcaatgtgggtgagatcttagaggatacatccaaatttcgtgggacttactcacaa 41790049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 106
Target Start/End: Original strand, 41762635 - 41762723
Alignment:
Q  18 aaagggacttagtttgatatatcccttttgcagagacaaacatcaatatgggtgagatctttgaggatacttccaaattgggtaggact 106  Q
    |||||||||||||||||| | ||||||||| ||| |  ||||||||| ||| ||||||||| ||||| ||||  ||||| ||| |||||    
T  41762635 aaagggacttagtttgatctttcccttttgtagatagcaacatcaatgtggatgagatcttagaggaaacttttaaattcggtgggact 41762723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University