View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1528_low_22 (Length: 201)

Name: NF1528_low_22
Description: NF1528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1528_low_22
NF1528_low_22
[»] chr5 (1 HSPs)
chr5 (5-116)||(42678608-42678719)
[»] chr3 (1 HSPs)
chr3 (15-55)||(54704090-54704130)


Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 5 - 116
Target Start/End: Original strand, 42678608 - 42678719
Alignment:
Q  5 ctccacaataaagactccattgacatgctccgccgtcagggtatcgacttctttcgtaacactgttcaaggtgtggactcgtttcattttgcgatgctga 104  Q
    |||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42678608 ctccacaacaaagactccattgacatgctccaccgtcagggtatcaacttctttcgtaacactgttcaaggtgtggactcgtttcattttgcgatgctga 42678707  T
Q  105 tgcggtggtctg 116  Q
    ||||||||||||    
T  42678708 tgcggtggtctg 42678719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 54704130 - 54704090
Alignment:
Q  15 aagactccattgacatgctccgccgtcagggtatcgacttc 55  Q
    |||| ||||||||||||||||||||||| ||||| ||||||    
T  54704130 aagattccattgacatgctccgccgtcaaggtattgacttc 54704090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University