View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1528_high_5 (Length: 264)

Name: NF1528_high_5
Description: NF1528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1528_high_5
NF1528_high_5
[»] chr2 (2 HSPs)
chr2 (141-223)||(30285945-30286027)
chr2 (21-87)||(30286075-30286141)


Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 141 - 223
Target Start/End: Complemental strand, 30286027 - 30285945
Alignment:
Q  141 gatgatgatggttttgtctagatgttgatgactctccttgttcaaaatgaattggttctgcaagaacaatctctgccatttct 223  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30286027 gatgatgttggttttgtctagatgttgatgactctccttgttcaaaatgaattggttctgcaagaacaatctctgccatttct 30285945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 21 - 87
Target Start/End: Complemental strand, 30286141 - 30286075
Alignment:
Q  21 tatcatagggacctggttgaaggtgttcatcattgctgctgctactaacactattggtagtaatagc 87  Q
    ||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  30286141 tatcaaagggacctggttgaaggtgttcatcattgctgctgctgctaacactattggtagtaatagc 30286075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University