View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15289_high_19 (Length: 325)

Name: NF15289_high_19
Description: NF15289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15289_high_19
NF15289_high_19
[»] chr1 (1 HSPs)
chr1 (38-256)||(8016563-8016778)


Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 38 - 256
Target Start/End: Complemental strand, 8016778 - 8016563
Alignment:
Q  38 ctctacctcttcttcaccatgttgctgatgcaatgtcttctgaaatgcgggctgggctttcctccgttgatgggcccgggcttcccatgataccaactta 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8016778 ctctacctcttcttcaccatgttgctgatgcaatgtcttctgaaatgcgggctgggctttcctccgttgatgggcccgggcttcccatgataccaactta 8016679  T
Q  138 tgtccacactcttccctccgggtatgtatgtcgtatgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttattat 237  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
T  8016678 tgtccacactcttccctccgggtatgtatgtcgtatgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttat--- 8016582  T
Q  238 tattgacatgatgatgatg 256  Q
    |||||||||||||||||||    
T  8016581 tattgacatgatgatgatg 8016563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University