View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15284_low_18 (Length: 279)

Name: NF15284_low_18
Description: NF15284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15284_low_18
NF15284_low_18
[»] chr8 (2 HSPs)
chr8 (9-127)||(39917790-39917908)
chr8 (182-279)||(39917640-39917737)


Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 9 - 127
Target Start/End: Complemental strand, 39917908 - 39917790
Alignment:
Q  9 atgaacacgcagcaaattaaaatagagatagaacagtgatacaaaaacagtacccaaatttatagcccaaaatattgggtaagacctctattcaacagtc 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  39917908 atgaacacgcagcaaattaaaatagagatagaacagtgatacaaaaacagtacccagatttatagcccaaaatattgggtaagacctctattcaacagtc 39917809  T
Q  109 aaccaccatagcaattagc 127  Q
    |||||||||||||||||||    
T  39917808 aaccaccatagcaattagc 39917790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 182 - 279
Target Start/End: Complemental strand, 39917737 - 39917640
Alignment:
Q  182 gtttcgaaattcgatactacaactaaactgtcctttgtcgttgacgttgttaactaagtaacagttacagcaacgttaacaactcagctatgctgtga 279  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  39917737 gtttcgaaattcgatactacaactaaactgtcctttgtcgttgacgttgttaactaagtaacagttacaacaacgttaacaactcagctatgctgtga 39917640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University