View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15283_low_22 (Length: 230)

Name: NF15283_low_22
Description: NF15283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15283_low_22
NF15283_low_22
[»] chr6 (2 HSPs)
chr6 (1-106)||(30917858-30917963)
chr6 (184-217)||(30917726-30917759)


Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 30917963 - 30917858
Alignment:
Q  1 ttttaattgattttatttaatttaaatttgtaccttgctttacatcttaagaaaactataacagtgttggcttggattatatatgtgaaaaaccattttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||  ||||||||||||    
T  30917963 ttttaattgattttatttaatttaaatttgtaccttgctttgcatcttaagaaaactataacagtgttggcttgcattatacatgttgaaaaccattttt 30917864  T
Q  101 tcatga 106  Q
    ||||||    
T  30917863 tcatga 30917858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 217
Target Start/End: Complemental strand, 30917759 - 30917726
Alignment:
Q  184 tttgtttttcatattttcatatctttatcatttc 217  Q
    ||||||||||||||||||||||||||||||||||    
T  30917759 tttgtttttcatattttcatatctttatcatttc 30917726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University