View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15283_low_20 (Length: 235)

Name: NF15283_low_20
Description: NF15283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15283_low_20
NF15283_low_20
[»] chr7 (2 HSPs)
chr7 (135-174)||(3775281-3775320)
chr7 (9-53)||(34671659-34671703)


Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 135 - 174
Target Start/End: Original strand, 3775281 - 3775320
Alignment:
Q  135 tatttaagaatactatagtgactttgagtcacccttatta 174  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  3775281 tatttaagaatactatagtgactttgagtcacccttatta 3775320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 53
Target Start/End: Original strand, 34671659 - 34671703
Alignment:
Q  9 gagggtgtaggaatgggggtggggagttggttggttgataatatt 53  Q
    |||||||| |||||||| ||||||||||| |||||||||| ||||    
T  34671659 gagggtgttggaatgggagtggggagttgattggttgatagtatt 34671703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University