View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15283_high_2 (Length: 481)

Name: NF15283_high_2
Description: NF15283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15283_high_2
NF15283_high_2
[»] chr1 (1 HSPs)
chr1 (419-467)||(27817115-27817163)


Alignment Details
Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 419 - 467
Target Start/End: Original strand, 27817115 - 27817163
Alignment:
Q  419 cgtatcacgcatattgttagactgtgttcatcgttcattttttcatatc 467  Q
    |||||||| | |||||||| |||||||||||||||||||||||||||||    
T  27817115 cgtatcacacctattgttaaactgtgttcatcgttcattttttcatatc 27817163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University