View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15282_low_2 (Length: 235)

Name: NF15282_low_2
Description: NF15282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15282_low_2
NF15282_low_2
[»] chr5 (1 HSPs)
chr5 (1-161)||(5042804-5042964)
[»] chr3 (1 HSPs)
chr3 (127-156)||(9311034-9311063)


Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 5042804 - 5042964
Alignment:
Q  1 attagaaccacaaatagaataagttttactatatctgatgtgagtgacaagctcacacaaacggacatggatttacagctagataattaaacnnnnnnnn 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||            
T  5042804 attagaaccacaaatagaataagttttactatatctgatgtgagtgacaagctcacacaaacagacatggatttacagctagataattaaacaaaaaagt 5042903  T
Q  101 nnnnntcaacaccgtattttttactttgatatgagaaatgatatttgtacaatcatgtaca 161  Q
         ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  5042904 aaaaatcaacaccgtattttttactttgatatgagaaatgatatttatacaatcatgtaca 5042964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 156
Target Start/End: Original strand, 9311034 - 9311063
Alignment:
Q  127 tgatatgagaaatgatatttgtacaatcat 156  Q
    ||||||||||||||||||||||||||||||    
T  9311034 tgatatgagaaatgatatttgtacaatcat 9311063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University