View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1527_high_10 (Length: 269)

Name: NF1527_high_10
Description: NF1527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1527_high_10
NF1527_high_10
[»] chr2 (1 HSPs)
chr2 (171-254)||(18099433-18099517)


Alignment Details
Target: chr2 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 171 - 254
Target Start/End: Original strand, 18099433 - 18099517
Alignment:
Q  171 aggagaaggtcttcaataagattaagatttgaaattgtcctttccatatgaacttc-aaatataggttgggtatttgaaccttgt 254  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  18099433 aggagaaggtcttcaataagattaagatttgaaattgtcctttccatatgaacttcaaaatataggttgggtatttgaaccttgt 18099517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University