View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15276_low_32 (Length: 237)

Name: NF15276_low_32
Description: NF15276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15276_low_32
NF15276_low_32
[»] chr5 (1 HSPs)
chr5 (14-221)||(22045675-22045882)


Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 14 - 221
Target Start/End: Original strand, 22045675 - 22045882
Alignment:
Q  14 caaaggcaaagtattgattgatatggctgagatatattgacatgacattgggtaagataacattgggacaattaaactttaaaaagattcccatgattat 113  Q
    |||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||    
T  22045675 caaaagcaaagtattgattgatatggctgagatatattgacatgactttgggtaagataacattgggacaattaaactttcaaaagattcacatgattat 22045774  T
Q  114 gtaagggaaatcaaagaatgcaatgataaggaatacttgtgtgcttgagaaaccaaatttgcatgtggcgtgtatttgtgctggtgttatctcttattgg 213  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  22045775 gtaagggaaatcaaagaatgcaatgataaggaatacttgtttgcttgagaaaccaaatttgcatgtgacgtgtatttgtgctggtgttatctcttattgg 22045874  T
Q  214 gaaacaaa 221  Q
     |||||||    
T  22045875 aaaacaaa 22045882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University