View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15276_low_17 (Length: 300)

Name: NF15276_low_17
Description: NF15276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15276_low_17
NF15276_low_17
[»] chr2 (2 HSPs)
chr2 (136-290)||(37914451-37914605)
chr2 (19-52)||(37914153-37914186)


Alignment Details
Target: chr2 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 136 - 290
Target Start/End: Original strand, 37914451 - 37914605
Alignment:
Q  136 ataagtcaaaatatgccatgtgtaaaatgagtggtgccagatgaaggtgattaaatatcgggaaatgatgagacatattttcaagttcaacttactcttt 235  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37914451 ataagttaaaatatgccatgtgtaaaatgagtggtgccagatgaaggtgattaaatatcgggaaatgatgagacatattttcaagttcaacttactcttt 37914550  T
Q  236 tctcatctcatttcaaaacaatacaacaacatgagcaacacaaacatgcttcatc 290  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37914551 tctcatctcatttcaaaacaatacaacaacatgagcaacacaaacatgcttcatc 37914605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 52
Target Start/End: Original strand, 37914153 - 37914186
Alignment:
Q  19 gagtgaggatgggtggtgaccgatgagcagtgag 52  Q
    |||||| |||||||||||||||||||||||||||    
T  37914153 gagtgaagatgggtggtgaccgatgagcagtgag 37914186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University