View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15270_low_11 (Length: 232)

Name: NF15270_low_11
Description: NF15270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15270_low_11
NF15270_low_11
[»] chr2 (1 HSPs)
chr2 (16-229)||(34675827-34676041)


Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 34676041 - 34675827
Alignment:
Q  16 tattttactt-gattttctattggtggctgaaaatgacatgactttttcataggtcccagaagttatataccaaactttagatgaaccacttggcaatga 114  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  34676041 tattttactttgattttctattggtggctgaaaatgacatgactttttcataggtcccagaagtgatataccaaactttagatgaaccacttggcaatga 34675942  T
Q  115 tgaactaaagggaaggtttgatattccacaaactttagaggagttcatggttaaaatgaaggaaggtggatatgatgccaaaacatttgcagttaaactt 214  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34675941 tgaactaaagggaaggtttgatattccacaaactttagaagagttcatggttaaaatgaaggaaggtggatatgatgccaaaacatttgcagttaaactt 34675842  T
Q  215 agagaaatggtacaa 229  Q
    |||||||||||||||    
T  34675841 agagaaatggtacaa 34675827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University