View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1526R-Insertion-12 (Length: 233)

Name: NF1526R-Insertion-12
Description: NF1526R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1526R-Insertion-12
NF1526R-Insertion-12
[»] chr1 (1 HSPs)
chr1 (9-213)||(8413647-8413848)


Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 9 - 213
Target Start/End: Original strand, 8413647 - 8413848
Alignment:
Q  9 agtgcttctcggcgcgtgcttgtgagtcgccgccgattcagcaactcttcttcttcttcatcatcgttgataactttcttcactagatgccgttcgagaa 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||    
T  8413647 agtgcttctcggcgcgtgcttgtgagtcgccgccgattcagcaactctt---cttcttcatcatcgttgataactttcttcactagatgccgttcgagaa 8413743  T
Q  109 gctcctcgatggtgtccggaccgtcgtgtaacaaccgccatgcgcaacagtttacggtttttggtttcagattcgaattccaaaggcttcgccattttcc 208  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8413744 gctcctcgacggtgtccggaccgtcgtgtaacaaccgccatgcgcaacagtttacggtttttggtttcagattcgaattccaaaggcttcgccattttcc 8413843  T
Q  209 tctca 213  Q
    |||||    
T  8413844 tctca 8413848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University