View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15261_low_9 (Length: 213)

Name: NF15261_low_9
Description: NF15261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15261_low_9
NF15261_low_9
[»] chr3 (1 HSPs)
chr3 (1-199)||(32783912-32784110)


Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 32784110 - 32783912
Alignment:
Q  1 ttcagtgtgtcaaaatgtaggtgttggtgatgacgaagctgaggatcacgagtgtttttcagctgcaggagatatagcttttcaaggacgaaggaaaagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32784110 ttcagtgtgtcaaaatgtaggtgttggtgatgacgaagctgaggatcacgagtgtttttcagctgcaggagatatagcttttcaaggacgaaggaaaagt 32784011  T
Q  101 gagagtggtggctttgacctgtctttatatatcaaaccagaaaatggaacagttgtgtacaatcctgcaatggaacatgaattgccgccatctaataat 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32784010 gagagtggtggctttgacctgtctttatatatcaaaccagaaaatggaacagttgtgtacaatcctgcaatggaacatgaattgccgccatctaataat 32783912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University