View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1525_1D_low_6 (Length: 251)

Name: NF1525_1D_low_6
Description: NF1525_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1525_1D_low_6
NF1525_1D_low_6
[»] chr1 (2 HSPs)
chr1 (7-91)||(23029232-23029316)
chr1 (166-234)||(23029091-23029163)


Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 7 - 91
Target Start/End: Complemental strand, 23029316 - 23029232
Alignment:
Q  7 atgaatgattacggaacgaaaattactaattcaaaagaaacggttgcataaataaaactaggagatataacattagaatttaccc 91  Q
    ||||||||||||||||||||||||||||  |||||||||||||||| |||||||||||||  || ||||||||||||||||||||    
T  23029316 atgaatgattacggaacgaaaattactagatcaaaagaaacggttgtataaataaaactactagctataacattagaatttaccc 23029232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 166 - 234
Target Start/End: Complemental strand, 23029163 - 23029091
Alignment:
Q  166 tggaggaaaggtttataaatcgatgtatatttgaataatgtgt----gtgagagaaagattttgtgaaggagg 234  Q
    ||||||| |||||||||||||||||||||||||||||||||||    | ||||||||||||||||||||||||    
T  23029163 tggaggagaggtttataaatcgatgtatatttgaataatgtgtgagagagagagaaagattttgtgaaggagg 23029091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University