View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15258_low_3 (Length: 205)

Name: NF15258_low_3
Description: NF15258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15258_low_3
NF15258_low_3
[»] chr4 (1 HSPs)
chr4 (50-174)||(36004965-36005097)


Alignment Details
Target: chr4 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 50 - 174
Target Start/End: Original strand, 36004965 - 36005097
Alignment:
Q  50 tgtgaccgccgttattatgtgtgggtgtcaaaagatgtatgccataaatggactgccg---------agattagctaaccctggaagaattgatataagg 140  Q
    ||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||         |||| ||||||||||||||||||||||||||||    
T  36004965 tgtgaccaccgttattatgtgtgggtgtcaaaagatgtatgtcataaatggactgccgctatagccgagatgagctaaccctggaagaattgatataagg 36005064  T
Q  141 acactggcgctaatgaacaaattgcgtggtccct 174  Q
    ||||| ||||||||||||||||||||||||||||    
T  36005065 acact-gcgctaatgaacaaattgcgtggtccct 36005097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University