View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15255_low_19 (Length: 224)

Name: NF15255_low_19
Description: NF15255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15255_low_19
NF15255_low_19
[»] chr1 (1 HSPs)
chr1 (13-150)||(3924993-3925130)


Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 13 - 150
Target Start/End: Complemental strand, 3925130 - 3924993
Alignment:
Q  13 cataggatgataataaatttcatactcataattgattcttgactcatgtacaccattcatgtgttcaattttgggatcaaatacagtatacattataaaa 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3925130 cataggatgataataaatttcatactcataattgattcttgactcatgtacaccattcatgtgttcaattttgggatcaaatacagtatacattataaaa 3925031  T
Q  113 ttttgactcatgtacttcttaattatggttcatatgac 150  Q
    ||||||||||||||||||||||||||||||||||||||    
T  3925030 ttttgactcatgtacttcttaattatggttcatatgac 3924993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University