View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15254_low_81 (Length: 205)

Name: NF15254_low_81
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15254_low_81
NF15254_low_81
[»] chr7 (1 HSPs)
chr7 (25-121)||(28103026-28103121)


Alignment Details
Target: chr7 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 25 - 121
Target Start/End: Original strand, 28103026 - 28103121
Alignment:
Q  25 aacacttcttagtgtaactcattaagttaatacattgatttctacatctatgactgcgccacatcaccaataaaaaatatgtcatctcttcttcccc 121  Q
    |||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  28103026 aacacttcttggtgcaactcattaagttaatagattgatttctacatctatgactgcgccacatcaccaat-aaaaatatgtcatctcttcttcccc 28103121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University