View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15254_low_58 (Length: 256)

Name: NF15254_low_58
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15254_low_58
NF15254_low_58
[»] chr3 (1 HSPs)
chr3 (116-242)||(40961644-40961770)


Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 116 - 242
Target Start/End: Complemental strand, 40961770 - 40961644
Alignment:
Q  116 tatttgttaactttttataacgcctacatcaaattcaaatcatcttacaaggatcataaataaattgttctttattggaggggaattaattaacttggtt 215  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40961770 tatttgttaattttttataacgcctacatcaaattcaaatcatcttacaaggatcataaataaattgttctttattggaggggaattaattaacttggtt 40961671  T
Q  216 aattttctaggtccaggatgttcctct 242  Q
    |||||||||||||| ||||||||||||    
T  40961670 aattttctaggtccgggatgttcctct 40961644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University