View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15254_high_73 (Length: 209)

Name: NF15254_high_73
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15254_high_73
NF15254_high_73
[»] chr7 (1 HSPs)
chr7 (13-137)||(6080677-6080801)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 13 - 137
Target Start/End: Original strand, 6080677 - 6080801
Alignment:
Q  13 atttatgtgtttaagttttgggtttaaatttgggtttatatccttgnnnnnnn-agaactcattgagcatatgttttcaaatgagtttgtaggatttttt 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||    
T  6080677 atttatgtgtttaagttttgggtttaaatttgggtttatatccttgttttttttagaactcattgagcatatgttttcaaatgagtttgtaggatttttt 6080776  T
Q  112 atgggttctttgttcatagaaataga 137  Q
    ||||||||||||||| ||||||||||    
T  6080777 atgggttctttgttc-tagaaataga 6080801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University