View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15252_low_4 (Length: 347)

Name: NF15252_low_4
Description: NF15252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15252_low_4
NF15252_low_4
[»] chr1 (2 HSPs)
chr1 (102-247)||(34561580-34561725)
chr1 (1-43)||(34561486-34561528)


Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 102 - 247
Target Start/End: Original strand, 34561580 - 34561725
Alignment:
Q  102 aaatctttgcctaaaaaggaatattttatccagatactataatctagtatagttttaggataatgtagtttgtttatattttctccgtacaaagaagtac 201  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34561580 aaatctttgcctaaaaaggaatattttatccagatactatagtctagtatagttttaggataatgtagtttgtttatattttctccgtacaaagaagtac 34561679  T
Q  202 tcgaattgaattattccgataatggccgatggaagataaggaatcg 247  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  34561680 tcgaattgaattattccgataatggccgatggaagataaggaatcg 34561725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 34561486 - 34561528
Alignment:
Q  1 tgtcactccagatgttccttttcaaacccttgatcttcaggta 43  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  34561486 tgtcactccagatgttccttttcaaacccttgatcttcaggta 34561528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University