View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15242_low_6 (Length: 286)

Name: NF15242_low_6
Description: NF15242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15242_low_6
NF15242_low_6
[»] chr7 (1 HSPs)
chr7 (20-267)||(46103718-46103965)


Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 267
Target Start/End: Original strand, 46103718 - 46103965
Alignment:
Q  20 tatcgctggcagttctttcccaccataacaaacatactatgcgagccagaaattgaaatgaaaacattaaaa-ttgcatgaatgaatttggtggtaatag 118  Q
    |||||||||||||||||||||||||||||| ||||||| ||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  46103718 tatcgctggcagttctttcccaccataacatacatact-tgcaagcgagaaattgaaatgaaaacattaaaaattgcatgaatgaatttggtggtaatag 46103816  T
Q  119 taatacaaaatcagtttcgttagtaaatcagcactcattcattcattcatcatggccatggccatggcctttcaaacaacacactcttatctaaccacaa 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46103817 taatacaaaatcagtttcgttagtaaatcagcactcattcattcattcatcatggccatggccatggcctttcaaacaacacactcttatctaaccacaa 46103916  T
Q  219 caaacttcatcttctcctctagtctcaaacgactcaccaaaccttctcg 267  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||    
T  46103917 caaacttcatcttctcttctagtctcaaacgactcaccaaaccttctcg 46103965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University