View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15241_low_2 (Length: 401)

Name: NF15241_low_2
Description: NF15241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15241_low_2
NF15241_low_2
[»] chr3 (1 HSPs)
chr3 (313-377)||(49205441-49205505)


Alignment Details
Target: chr3 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 313 - 377
Target Start/End: Original strand, 49205441 - 49205505
Alignment:
Q  313 agatgataattgagtgcagatcaaattgcaatgttaaaaattgtgaaaggaaagaacgatcatga 377  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49205441 agatgataattgagtgcagatcaaattgcaatgttaaaaattgtgaaaggaaagaacgatcatga 49205505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University