View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1523_low_68 (Length: 214)

Name: NF1523_low_68
Description: NF1523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1523_low_68
NF1523_low_68
[»] chr6 (1 HSPs)
chr6 (16-199)||(15638067-15638250)


Alignment Details
Target: chr6 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 15638250 - 15638067
Alignment:
Q  16 aatatttagctgcaacaggatgtttgaaacaacaaaaggagaacaaaaacatgtatgcaactggaatggtgaagatgatttgttgtgaaacggagatatc 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||    
T  15638250 aatatttagctgcaacaggatgtttgaaacaacaaaaggagaacaaaaacatgtatgcaacagggatggtgaagatgatttgttgtgaaacggagatatc 15638151  T
Q  116 atcaggaaagaatgtaaagtgtttagggacaagaagtagtgaaaatggttgctttgtactttggcaaatgttgccaggaatgtg 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15638150 atcaggaaagaatgtaaagtgtttagggacaagaagtagtgaaaatggttgctttgtactttggcaaatgttgccaggaatgtg 15638067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University